HomeВидеоигрыRelated VideosMore From: DanTDM

Minecraft | DNA SCIENCE! (Gain the Powers of ANY Minecraft Mob!) | Mod Showcase

125966 ratings | 14845861 views
"CAN WE GET TO 10,000 LIKES?" ► Next: https://www.youtube.com/watch?v=1Oyo3rCXORY&index=16&list=PLUR-PCZCUv7Te0KbzR6rpaD9rXORtYib2 ► Previous: https://www.youtube.com/watch?v=vI6brwEUfME&index=14&list=PLUR-PCZCUv7Te0KbzR6rpaD9rXORtYib2 ► Subscribe and join TeamTDM! :: http://bit.ly/TxtGm8 ► My Twitter :: http://www.twitter.com/DiamondMinecart ► Mod Showcases Playlist 2: https://www.youtube.com/watch?v=BHDL8BVUOFc&index=1&list=PLUR-PCZCUv7Te0KbzR6rpaD9rXORtYib2 Today, we take on some really cool science experiments involving mine and other Minecraft Mobs' DNA! By combining my DNA with a Minecraft Mob, I can gain amazing powers such as an Enderman's Teleporting, Creeper's Explosion and tonnes more! This is definitely a mod you should check out.. ► Get the DNA Mod: http://www.minecraftforum.net/topic/1988826-164-forge-advanced-genetics-mod/ ► Want To Send Me Something? :: The Diamond Minecart / DanTDM Office 34 67-68 Hatton Garden London EC1N 8JY UK ► Merchandise! US: http://thediamondminecart.spreadshirt.com UK: http://thediamondminecartuk.spreadshirt.co.uk EU: http://thediamondminecart.spreadshirt.net Enjoy & remember to like, favourite and subscribe to support me! -- Find Me! -- Twitter: http://www.twitter.com/DiamondMinecart Facebook: http://www.facebook.com/TheDiamondMinecart Instagram: DanTDM Skydaz: http://www.skydaz.com -- Easy Mod Installers! -- Credits -- All titles and images created by TheDiamondMinecart Title song: Super Street Fighter Remix - AntoineLavenant - https://soundcloud.com/antoinelavenant Spy Theme: Hitman - Kevin Macleod - http://incompetech.com/music/royalty-free/index.html?isrc=USUAN1300013
Category: Видеоигры
Html code for embedding videos on your blog
Text Comments (7502)
Alicia Gonzalez (7 days ago)
Cool. Dna.
Alicia Gonzalez (7 days ago)
Hi. Dna. 💎💎👍👍👍👍👍
tony elicker (8 days ago)
I Love you. I am Sarah tdm
Elsi Diaz (24 days ago)
2018
Summer Plays (29 days ago)
What is your favourite posh on efekt
Remy Gladden (29 days ago)
Minecraft was invented by A.I.?
vloger hd (1 month ago)
Dna code GTAAACTAGCTATATATATGGGCGCGAGATGAGACGATGCATGCAGTAGCAGGGGCCATATAGCTATATCAATACATACTACGATCAGATACTAGACTAGCAGTAGATAACTACAGTATACAGATCATTACAGTACAGTAGCATGACGTAGACTGACTGATGCATGATGCAGTAGCTAGTCAGTGATGACGATAGCATGACAGTACAGATGCATGATCGATGCGATGCATGACGATGCATGATGATCATGCAGATC WHAT KIND OF CREATURE IS THIS
Shadow_boy80 (1 month ago)
Super Dantdm
Crashlands Jade (1 month ago)
DAN MY FAV MOB AND DNA IS ENDERMAN TOO!!
Aiden Crosby (1 month ago)
Eating grass is 4 dogs
Aiden Crosby (1 month ago)
Dan do u have a Batman mod
Jaden LeMieux (1 month ago)
“We can’t milk trayaurus, that may be a bug...”
Tyler TheButterman (1 month ago)
Anyone else notice that Dan and Adam (Skydoesminecraft) both hate squids (Sky Army; his subs, are the Squid Army enemy)
Neo Hamm (1 month ago)
13:18) i saw on the syringe that the cow power was "infinite milk," so i think what actually happens is that you can infinitely milk a cow. same for mooshroom.
Neo Hamm (1 month ago)
and also same goes for infinite shearing.
Evan Cox (1 month ago)
i loove your videos
Evan Cox (1 month ago)
me too
Ernalyn Alegre (1 month ago)
i
DJ TwilightGamer (1 month ago)
In the chest i think you missed an effect plus we don't know what woolly does
Ruth Ellaine Mancilla (1 month ago)
Thank you DAN you always make me happy when im sad thank you
Lizard Odyssey (1 month ago)
WOW
Yurema Rodriguez (1 month ago)
How
Yurema Rodriguez (1 month ago)
Go
Jen (1 month ago)
You
Jen (1 month ago)
Poooooop
lilis suryani (1 month ago)
Wow you can fly in survival mode
Jacob bright (1 month ago)
do not go to link it has viruses
Ugandan Knuckles (1 month ago)
U sound sad
RAMBIE 408 (2 months ago)
It would be scary in real life. But actually fun
Jennifer Manley (2 months ago)
Omg😋 so cool
Savannah F (2 months ago)
what kind of Minecraft do you play
sel soul (2 months ago)
I do
3toisyou (2 months ago)
The old intro... never gets old
Jordan Cross (2 months ago)
I ate a flower beforw
Cheesey Lord of tape (2 months ago)
Any one 2018 or just me?
*sees grass* Dan: UNLIMITED POWAAAHHHH
Richguy37 (2 months ago)
eating grass isn't a super power, anyone can do that, lol but still worst thing ever lmfao
iCandyYT (2 months ago)
Im gonna get this mod so I can breathe water. Then it'll be a lot easier doing my mermaid roleplay :P
N R Phullay (2 months ago)
an overclocker not a
be be (2 months ago)
Dan TDM I want to see one person
brasil
Eli Crunk (2 months ago)
Keep makeing videos
nick lis (2 months ago)
science
dancing shark 77 (2 months ago)
please dont say dam
the gaming Harris (2 months ago)
OSOM
Z.A.P 0909Y (2 months ago)
house is not done yet
William Rhodes (2 months ago)
WHY does the entrance look different
Tracy strawser (2 months ago)
Blaze and creeper controls spell F U
Gmonster 2323 (2 months ago)
"DNA spitter" ........ what??
Daniel Chambers (2 months ago)
???
The Kraken Network (2 months ago)
Love your video but the reason you don’t get damaged is because it’s fall damage
epic gamer (2 months ago)
where do you get your mods
Chantelle Clark (2 months ago)
what is the song that plays at the start of every video
Mini Lily Fun (2 months ago)
Keep inventory is already a thing in vanilla Minecraft
Jonah Giles (2 months ago)
Wooooowwwweeee!
Greg b (3 months ago)
combine this with the form change mod and just wow I have not tried tho just a suggestion
shay pope (3 months ago)
Ok
Augutė Baubonienė (3 months ago)
Dan.Can you make a video of building your cuntry?
Amber Newton (3 months ago)
Dabbing was the time to tell
Amber Newton (3 months ago)
Hi
Rebecca Smith (3 months ago)
why did dan swear so muck still love you dan
hayley badonk (3 months ago)
im ur biggest fan
Skylanderlover 725 (3 months ago)
Ahhh the old days of dan
Douglas Bottoms (3 months ago)
can u stop saying bad words please
Douglas Bottoms (3 months ago)
sorry i thot it was funny
Douglas Bottoms (3 months ago)
wow such good
Mr. Wheezy (3 months ago)
so i can milk a minecart?
redstoneMINCART (3 months ago)
Dna? What happens when you use ALL of the DNA stuff?
lili ji (3 months ago)
cool
Veronica Dancy (3 months ago)
You sed the D word
Logocorp _ (3 months ago)
You shear and milk YOU
Rachelle Bennett (3 months ago)
DanTDM why do you say bad words all the time
Jack Attack (3 months ago)
That’s not a super power I can do that
Wait does that mean someone could steal your DNA?
Abhi Gamer (3 months ago)
_Cell of a sheep_
Colwyn Simmons (3 months ago)
Wow that is Asomum
Willybearrekker (3 months ago)
When ur mum says u must eat up ur grass.
Fun With Ariyan (3 months ago)
How did you do infinitly
Jimmy Pitcher (3 months ago)
yes yes yes
Can you make your own texter pack
Kurt Houweling (3 months ago)
you killed my faverot animal THE OCELOT
Natalie Caruana (3 months ago)
oh ok
Natalie Caruana (3 months ago)
GASP OMFG mine is not working
Natalie Caruana (3 months ago)
my syringere went into my eye
Natalie Caruana (3 months ago)
And I olny had 1  helix
Natalie Caruana (3 months ago)
mine did only say basic gene not the explode yourself gene which I was going for
Natalie Caruana (3 months ago)
and then I skipped the things to get the complet on
Natalie Caruana (3 months ago)
that is when I quited my life
Lee Jenkins (4 months ago)
I love you dantdm your the best I watch you ever day
Building Bjørn (4 months ago)
I dunno hearing him say Damn sounds normal but people started complaining
Carlo Lim (4 months ago)
Is that dantdm’s old lab old version? Look at the entrance!
Carlo Lim (4 months ago)
MOST COMPLEX MOD EVER
Yew Che Mak (4 months ago)
The day harvested is probably decomposing into an oblivion and have an error causing Dan to be a part of a new species. I can explain the whole thing but I think it is too much complicated
Damion Vermillion (4 months ago)
I'm un subing to you
Addison BROWN (4 months ago)
When I was about maybe four or five I used to eat grass where my dog went to the toilet
With The Littles (4 months ago)
[]{}#%^*+=qaxxsaxwwS-12/=________
geezerfetus (4 months ago)
Hi
emma pop (4 months ago)
Come on guys let's get Dan TDM to 200000
Tima Hammoud (4 months ago)
2018?
Danny Pittman (4 months ago)
Haha the end
Connor Stephens (4 months ago)
play hand simulator
Ninja Gecko (4 months ago)
I eat grass it isn't really a superpower
OWWW MY HEAADDD HHHUUURRRRTTTTTSSSS OOOOFFFF KNOWLAGE OWWWW MY HEEEAAADDDD
Marshy The mellow (4 months ago)
WHO IS WATCHING IN 1926!!!!!!!!
CatCat_77 T_T (4 months ago)
I'm glad I did not watch this when I got a shot at the doctor
Lanz_The_ Gamer (4 months ago)
DanTDM evolves into MoreTDM
Ry Am (4 months ago)
shear dr.t.
Bendy (4 months ago)
Ry Am we can't

Would you like to comment?

Join YouTube for a free account, or sign in if you are already a member.